Submitted 5 February 2020, Accepted 5 May 2020, Published 18 May 2020 Corresponding Author: Yousef Sultan – e-mail – sultanay18@hotmail.com 142 New genotypes of aflatoxigenic fungi from Egypt and the Philippines AboDalam TH1, 4, Amra H1, Sultan Y1*, Magan N2, Carlobos-Lopez AL3 and Cumagun CJR3, Yli-Mattila T4 1Food Toxicology and Contaminants Department, National Research Center, Dokki, Cairo, Egypt 2Applied Mycology Group, AgriFood Institute, Cranfield University, Cranfield, Bedford MK43 0AK, United Kingdom 3Institute of Weed Science, Entomology and Plant Pathology, College of Agriculture and Food Science, University of the Philippines Los Baños, Laguna 4030, Philippines 4Molecular Plant Biology, Department of Biochemistry, University of Turku, FI-20014 Turku, Finland AboDalam TH, Amra H, Sultan Y, Magan N, Carlobos-Lopez AL, Cumagun CJR, Yli-Mattila T 2020 – New genotypes of aflatoxigenic fungi from Egypt and the Philippines. Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 10(1), 142–155, Doi 10.5943/cream/10/1/15 Abstract Aflatoxins (AFs), mainly produced by Aspergillus section Flavi, are the major natural toxins of crops and commodities in hot climatic geographic regions. These toxins are considered as type A carcinogens. One hundred and sixty single spore isolates of A. section Flavi were isolated from two different geographical places, Egypt and the Philippines. A quarter (26.5%) of the isolates was able to produce AFs. Four chemotypes of aflatoxin-producing fungi were obtained. Surprisingly, all aflatoxin-producing A. nomius isolates produced higher amounts (2400-40400 ng ml-1) of total AFs (AFB1, AFB2, AFG1 and AFG2) than the toxigenic A. flavus isolates (<1200 ng ml-1). All isolates producing AFs gave PCR products with the ver-1/ver-2 and ordAF/ordAR primers, which amplify ver-1 and ordA genes in the aflatoxin biosynthetic pathway. Based on PCR products of ver-1 gene, new genotypes of aflatoxigenic fungi were found which revealed the variability of AFs production between different isolates depending on the region of the isolation. Key words – PCR – aflatoxin – fungi – Aspergillus section Flavi Introduction Aflatoxins (AFs) are highly toxic secondary metabolites, mainly produced by species in the Aspergillus section Flavi group, including Aspergillus flavus and A. parasiticus (Sultan & Magan 2010). A. nomius is also found to produce AFs (Kumeda et al. 2003, Ehrlich et al. 2007). They significantly affect food and feed production because of their toxic effects on humans and animals that include carcinogenic, mutagenic, teratogenic, and immunosuppressive effects (Cullen et al. 1987, Iyer et al. 2010). These toxins consist of around 20 related secondary metabolites, although only aflatoxins B1, B2, G1 and G2 are normally found in foods (CAST 2003). Aflatoxins, especially aflatoxin B1, have been shown to induce liver cancer (hepatocellular carcinoma, HCC) in laboratory and wild animal species, including subhuman primates (Alberts et al. 2006, Wogan et al. 2012). Because of health issues, AFB1 and the total AFs in food for direct human consumption are strictly regulated by the EU at 2 and 4 ppb, respectively (European Commission 2010). Current Research in Environmental & Applied Mycology (Journal of Fungal Biology) 10(1): 142–155 (2020) ISSN 2229-2225 www.creamjournal.org Article Doi 10.5943/cream/10/1/15 143 Isolates of Aspergillus section Flavi can grow over a wide temperature range of 17-42°C but the optimum for AFs production is 25-35°C. For this reason, AFs have often been considered as the major contaminants in countries with hot climates (Cotty & Jaime-Garcia 2007). Egypt is known to have such a hazard in tropical cereals and other foods or raw materials (el- Tahan et al. 2000). Moubasher et al. (1977) tested 45 isolates of Aspergillus species isolated from soil, seed grains (maize, wheat, and peanut) and air for the production of mycotoxins. Thirty isolates exhibited toxicity, whereas three of them were strongly toxigenic. Since Philippines’ weather is always warm coupled with high relative humidity (80-90% at wet season and 50-70% at dry season), AFs contamination in crops, food and feed commodities is considered also a serious problem (Ilag 1984, Garcia & Ilag 1986, Lubulwa & Davis 1994, Arim 2004). Among the five Southeast Asian nations, the Philippines had the highest level of aflatoxin B1 contamination in maize but had the least contaminated samples (Balendres et al. 2019). The AF biosynthetic pathway in several Aspergillus spp. has been well characterized and most of the genes involved have been identified (Prieto & Woloshuk 1997). These genes exist as a gene cluster located in a 70-kb DNA sequence, which contains at least 25 open reading frames (ORFs) (Yu et al. 2004). At least 25 genes are involved in the biosynthesis of AFs and its regulation (Bhatnagar et al. 2006). Several regulator genes such as aflR and aflJ, involved in the pathway are also reported as a part of this cluster (Cary et al. 2006). In this multistep polyketide pathway, the NOR1 (aflD gene) mediates the first step in the AF biosynthetic pathway (Chang et al. 1992). Primers on sequences of afl-2, aflD, aflM and aflP, (apa-2, nor-1, ver-1, omt-A, respectively) (Geisen 1996, Shapira et al. 1996, Chen et al. 2002) have been used to detect and identify aflatoxigenic strains of A. flavus and A. parasiticus isolated from different commodities. Multiplex RT–PCR containing 4-5 primer pairs of various combinations of aflD, aflO, aflP, aflQ, aflR and aflS (aflJ) have also been used to detect toxigenic fungi (Degola et al. 2007). The biodiversity of aflatoxigenic strains is dramatically affected by climate change overall the world (Cotty & Jaime-Garcia 2007, Magan et al. 2011). Temperature, water activity of the commodities and the carbon dioxide percentage are the most factors affecting the biodiversity. Interaction of such factors was found to stimulate expression of aflD and aflR during AF biosynthetic pathway by A. flavus (Medina et al. 2015). This emphasizes the importance of updating all data belonging to the aflatoxigenic fungi in different climate regions. The objectives of this study were (a) to generate information on the diversity of A.section Flavi species isolated from Egypt and the Philippines as different geographical regions and their capacity for AFs production, (b) to test selective primers designed for distinguishing the aflatoxin production efficacy by these isolates, and (c) to utilize PCR results and AFs analysis data to classify the isolated aflatoxigenic fungi into chemo- and genotypes. Materials & Methods Sampling Thirty five samples were collected from each country. The Egyptian samples were collected from 5 governorates in the north of Egypt between latitudes 28 and 30° North and longitudes 29 and 31° East (Anon 2001) representing nine soil samples, 15 maize, nine wheat samples, one air sample and one lab bench swab sample. From the Philippines, samples were collected from different provinces of Mindanao and Visayas islands which locate between latitudes 5 and 10° North and longitudes 121 and 126° East (Anon 2001). Samples were divided into 23 soil, 6 maize, 2 coconut and 4 peanut samples. Table 1 shows the collection sites and the isolates ‘codes. Fungal isolation using species-specific medium and single-spore preparation The isolates of Aspergillus section Flavi were collected using the specific medium Aspergillus flavus/parasiticus Agar (AFPA) (Cotty 1994). A yellow-orange reverse color was a marker sign of their growth. Direct plating was applied for grain samples. Five grains of either maize or peanut samples and 10 grains of wheat samples were surface disinfected with 5% sodium 144 hypochlorite (NaOCl) for 1 min followed by rinsing three times with sterile water. The disinfected grains were plated on AFPA medium and incubated for 5 days at 25°C. Serial dilution of soil and coconut samples (2 g sub-samples) using 6 ml sterile distilled water in sterile polystyrene tubes were mixed on a rolling mixer for 20 min (Donner et al. 2009). One hundred microliters of each supernatant were spread onto 90-mm AFPA agar plates. Regarding the air sample, AFPA plates was opened in the collecting place for 5 min. Swab sample was also spread directly on the medium. After incubation, the colonies with yellow-orange reverse color were transferred to PDA plates and single spore isolates were prepared from each isolate by serial dilution of spore suspensions and spreading the spores on water agar Petri plates. The plates were incubated for 12h. After this, three single spores were picked off under a dissecting microscope and inoculated on PDA medium for 24h. The youngest colony was used as a source for inoculation of PDA-Eppendorf tubes, which contained 0.5 ml of PDA medium in 1.5 ml sterilized Eppendorf tubes. All single spore isolates have been preserved in the small culture collection in Department of Biochemistry, University of Turku, Finland and another copy of them have been sent to the culture collection in All-Russian Institute of Plant Protection (VIZR), Petersburg-Pushkin, Russia. Table 1 Isolates codes, their sources and collection sites Isolate code Collection site 1E Maize sample (Balady*)from Awsiem Tuesday market, Giza 3E Maize sample (Balady Bahary*) from Awsiem Tuesday market, Giza 16E Maize sample from El-Monufia 21E Yellow maize sample from El-Beheira 23E Maize sample (Hokoma*) from El-Beheira 29E Soil sample from Eltarbeaa area in Awsiem, Giza 34E Soil sample from Tanta, El-Gharbia 35E Soil sample from Eltarbeaa area in Awsiem, Giza 40E Wheat sample from Awsiem, Giza 41E Wheat sample from Tanta, El-Gharbia 42E Soil sample from el-Mansoria, Giza 43E Yellow maize sample from El-Faiyum 44E Lab bench swab sample from Mycotoxin lab, Food Toxicology and Contaminants Dept., National Research Centre, Dokki, Giza, Egypt 45E Air sample from Mycotoxin lab, Food Toxicology and Contaminants Dept., National Research Centre, Dokki, Giza, Egypt. 6P Soil sample from a field of coconut in Situbo, Tampilisan, Mindanao 7P Soil sample from a field of coconut in Situbo, Tampilisan, Mindanao 8P Soil sample from a field of coconut in Situbo, Tampilisan, Mindanao 9P Soil sample from a field of coconut in Situbo, Tampilisan, Mindanao 10P Soil sample from a field of coconut in Situbo, Tampilisan, Mindanao 18P Soil sample from a field of maize in New Barili, Tampilisan, Mindanao 32P Soil sample from a field of maize in Garimbara, Visayas 33P Soil sample from a field of maize in Garimbara, Visayas 34P Soil sample from a field of maize in Garimbara, Visayas 35P Soil sample from a field of maize in Garimbara, Visayas 36P Soil sample from a field of peanut in Bagay, Visayas 41P Soil sample from a field of peanut in Malingin, Visayas 42P Soil sample from a field of peanut in Malingin, Visayas 43P Soil sample from a field of peanut in Malingin, Visayas 44P Soil sample from a field of peanut in Malingin, Visayas 45P Soil sample from a field of peanut in Malingin, Visayas 59P Peanut sample from Visayas 86P Soil sample from a field of maize in Libertad, Visayas 87P Soil sample from a field of maize in Libertad, Visayas 88P Soil sample from a field of maize in Libertad, Visayas 145 Table 1 Continued. Isolate code Collection site 89P Soil sample from a field of maize in Libertad, Visayas 90P Soil sample from a field of maize in Libertad, Visayas 96P Soil sample from a field of coconut in Caimbaran, Visayas 97P Soil sample from a field of coconut in Caimbaran, Visayas 107P Soil sample from a field of coconut in Kabangkalan, Visayas 108P Soil sample from a field of coconut in Kabangkalan, Visayas 109P Soil sample from a field of coconut in Kabangkalan, Visayas 110P Soil sample from a field of coconut in Kabangkalan, Visayas 112P Peanut sample from Visayas E = Egypt, P = Philippines, * = the commercial name of the grain Fluorescence detection of aflatoxin-producing isolates and phenotypic identification Coconut agar medium (CAM) was used as a simple detection of isolates producing aflatoxin (Lin & Dianese 1976). Briefly, 100 g of shredded coconut were homogenized for 5 min with 200 ml of hot distilled water. The homogenate was filtered through cheesecloth, and then the agar (2%) was added and the medium autoclaved. The plates were inoculated with PDA plugs of Aspergillus strains and incubated at 25°C for 5 days. The reverse side of the plates was periodically observed under 365 nm UV light for blue fluorescence as an indicator of aflatoxins production. The positive aflatoxin-producing isolates were identified according to phenotypic characteristics based on the growth patterns on AFPA, Czapek yeast autolysis (CYA), malt extract sucrose agar (MEA) and yeast extract sucrose agar ,YES after 7 days at 25°C (Rodrigues et al. 2011, Varga et al. 2011). Aflatoxin determination Each isolate was inoculated on 500 μl of yeast extract sucrose (YES) in an Eppendorf tube and incubated for seven days. Aflatoxins were extracted as follows: 500 μl chloroform was added to each Eppendorf and vortexed well. The chloroform extract was transferred to a new vial and dried gently under air. Dry film was derivatized according to AOAC (2019) and then analyzed quantitatively using HPLC. A 200 μl stock solution of AFs mix standard in methanol (Supelco, Bellefonte, Pa., USA), containing 200 ng B1, 60 ng B2, 200 ng G1 and 60 ng G2, was dried under nitrogen gas and derivatized. Four different concentrations of working standard solution were used for calibration curve preparation of each AF type. HPLC conditions The HPLC system used for AFs analyses was an Agilent 1200 series system (Agilent, Berks., UK) with a fluorescence detector (FLD G1321A), an auto sampler ALS G1329A, FC/ALS therm G1330B, Degasser G1379B, Bin Bump G1312A and a C18 (Phenomonex, Luna 5 micron, 150 × 4.6 mm) column joined to a pre-column (security guard, 4 × 3-mm cartridge, Phenomenex Luna). The mobile phase was water /methanol /acetonitrile (60: 30:10, v/v/v) using an isocratic flow rate of 1 ml min-1 at 360 nm excitation and 440 nm emission wavelengths and a 25-min run time for AF analyses. Under these conditions, the LOD levels were 0.042, 0.015, 0.023 and 0.012, whereas LQD levels were 0.131, 0.045, 0.072 and 0.032 (ng injection-1) for AFG1, AFB1, AFG2 and AFB2, respectively. DNA extraction and PCR The Aspergillus isolates were cultured in 0.5 ml of malt extract broth medium (30 g malt extract and 5 g peptone l-1) in Eppendorf tubes at 25°C for three days, after which the mycelium was transferred to a new Eppendorf tube. DNA was extracted from isolates using both octanol/isopropanol method as described by Paavanen-Huhtala et al. (1999) and GenElute™ Plant Genomic DNA Kit (Sigma-Aldrich, St. Louis, MO, USA) as described by Yli-Mattila et al. (2008). Quality of DNA extraction was confirmed using ITS1 and ITS4 (Table 2) primers amplifying ITS 146 (the internal transcribed spacer) region of fungi DNA as described by Yli-Mattila et al. (2004). [XE “Multilocus genotyping”] Primers pairs ver-1/ver-2 and ordAF/ordAR (Table 2) which are specific for ver-1 and ordA genes in aflatoxin biosynthetic pathway respectively, were used for the detection of aflatoxin production by aflatoxigenic isolates as described by Färber et al. (1997) and Chang et al. (2005) (Table 2). MJ Research thermal cycler (PTC-200) was used for PCR amplification. Table 2 Sequences of primer pairs used in PCR: ITS 1/ITS4 for testing the quality of DNA and ver- 1/ver-2 and ordA-F/ordA-R for detecting ver-1 gene and ordA gene in aflatoxin-producing fungi respectively. Primer 5’ > 3’ sequence Target sequences and species Amplicon size (bp) Authors ITS1 ITS4 TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC Fungal Ribosomal DNA 650-700 Yli-Mattila et al. (2004) ver-1 ver-2 GCCGCAGGCCGCGGAGAAAGTGGT GGGGATATACTCCCGCGACACAGCC ver-1 gene 537 Färber et al. (1997) ordA-F ordA-R AAGGCAGCGGAATACAAGCG ACAAGGGCGTCAATAAAGGGT ordA gene 400 Chang et al. (2005) Determination of the PCR products molecular weight Aliquots (8 μl) of each PCR product were analyzed by electrophoresis in a TBE buffer in 1.0% agarose gels and visualized by using Alpha Innotech Corporation MultiImage Light cabinet with camera and filters. The gel photos were analysed by using the GEL program (Patzekin and Klopov, Petersburg Nuclear Physics Institute, Russia) to determine the molecular weight of the PCR products and the PCR products profile from different isolates (Yli-Mattila et al. 2004). Molecular identification of the strains The identification of ten Aspergillus isolates was performed by sequencing their ITS region as a confirmation step of the morphological identification. The gene sequence of each isolate was amplified using the primers ITS1 and ITS4 as described by Yli-Mattila et al. (2004). The PCR mixtures were made to a final volume of 25 μL, involving template DNA (1.0 µL), 1× PCR buffer, 0.25 mM dNTPs, 50 µM of each primer, and 2 U Taq DNA polymerase. The amplified PCR products were sequenced by The Institute for Molecular Medicine Finland (FIMM) and the DNA sequences were aligned using advanced BLAST searches (http://www.ncbi.nlm.nih.gov/). The sequences were submitted to GenBank. Phylogenetic analyses were performed as described by Yli- Mattila et al. (2018). Statistical analysis Statistical significance was determined using Statistica Version 9 (StateSoft, Tulsa, OK, USA). The means of AFs concentrations were determined by analysis of variance (ANOVA, two- way analyses) (P<0.05). Fisher’s LSD method (=0.05) was applied to compare significant differences in AFs production between the strains. Results Aspergillus isolates: A total of 160 A. section Flavi isolates that gave a yellow-orange reverse color on AFPA medium were isolated from 70 samples (32 soil, 21 maize, 9 wheat, 4 peanuts, 2 coconuts,1 lab bench swab and 1 air sample) representing 45 isolates from Egyptian samples and 115 isolates from the Philippines. Single spore isolates of aflatoxin-producing fungi were identified according to their phenotypic properties on AFPA, CYA, MEA, YES and their AFs production. Aflatoxin production: In general, 26.5% (43) of the tested isolates (Table 3) were able to produce AFs, 14 from Egypt and 29 from the Philippines. All aflatoxigenic Egyptian isolates and 23 from the Philippines were morphologically identified as A. flavus, whereas the other 6 147 Philippine isolates (21%) were A. nomius. They looked yellow to light green with white fluffy appearance notably on YES medium, whereas the colonies of A. flavus isolates had more greenish color forming intensive conidia on both MEA and YES. Existing uni and bi-seriates in the conidial heads of A. flavus isolates was a unique character used for distinguishing them from A. parasiticus isolates. Table 3 Morphological identification, aflatoxins production on CAM and the concentration in YES medium using HPLC. The number of + refers to the density of the blue fluorescence of the reverse side of the colonies under the UV lamb. ND= not detected. Isolate code Identification CAM Aflatoxins concentration in YES broth (ng ml-1 medium + SE) G1 B1 G2 B2 Total AFs 1E* A. flavus + ND 26.70 + 2.26 ND ND 26.70 + 2.26 3E A. flavus ++ ND 721.90 + 65.45 ND 6.30 + 0.93 728.20 + 66.03 16E* A. flavus + ND 22.60 + 2.52 ND 0.19 + 0.05 22.79 + 2.55 21E* A. flavus + ND 113.60 + 9.38 ND 2.30 + 0.26 115.90 + 9.63 23E A. flavus + ND 45.60 + 3.99 ND 0.15 + 0.04 45.75 + 4.04 29E A. flavus + ND 44.50 + 2.51 ND ND 44.50 + 2.51 34E A. flavus + ND 0.50 + 0.07 ND ND 0.50 + 0.07 35E A. flavus + ND 3.40 + 0.35 ND ND 3.40 + 0.34 40E A. flavus + ND 201.00 + 9.56 ND 9.50 + 1.07 210.50 + 10.62 41E A. flavus + ND 432.60 + 20.54 ND 17.91 + 1.47 450.50 + 22.31 42E* A. flavus + ND 17.70 + 1.014 ND ND 17.70 + 1.01 43E A. flavus ++ ND 803.00 + 23.99 ND 49.00 + 4.81 852.00 + 28.58 44E A. flavus + ND 227.00 + 14.00 ND 17.00 + 2.65 244.00 + 15.62 45E* A. flavus + ND 1.30 + 0.23 ND ND 1.30 + 0.23 6P A. nomius +++ 26237.2 0 + 1951.70 13188.80 + 1547.29 462.30 + 31.92 487.97 + 27.90 40375.47 + 1957.26 7P* A. nomius +++ 3973.50 + 190.80 1983.00 + 145.01 70.80 + 4.62 50.20 + 7.63 6077.50 + 347.88 8P A. nomius +++ 2198.50 + 205.80 1235.60 + 129.45 41.50 + 5.785 30.40 + 5.73 3506.00 + 342.20 9P* A. nomius +++ 1526.60 + 115.40 825.20 + 83.63 26.90 + 2.57 23.00 + 2.60 2401.70 + 203.63 10P A. nomius +++ 12950.3 0 + 989.80 5001.30 + 207.27 224.60 + 11.56 146.70 + 6.18 18322.90 + 1174.09 18P A. flavus + 4.00 + 0.24 3.60 + 0.19 ND ND 7.60 + 0.43 32P* A. flavus + 0.42 + 0.04 1.60 + 0.21 ND ND 2.02 + 0.25 33P A. flavus + 0.60 + 0.04 1.60 + 0.23 ND ND 2.20 + 0.27 34P A. flavus + 0.30 + 0.15 1.20 + 0.17 ND ND 1.50 + 0.37 35P A. flavus + 0.40 + 0.05 1.30 + 0.07 ND ND 1.70 + 0.06 36P A. flavus + ND 1.70 + 0.15 ND ND 1.70 + 0.15 41P A. flavus ++ ND 360.50 + 17.44 ND 4.80 + 0.32 365.30 + 17.69 42P A. flavus ++ ND 822.00 + 33.86 ND 9.10 + 0.44 831.10 + 34.28 43P A. flavus + ND 231.20 + 37.66 ND 1.30 + 0.18 232.50 + 13.48 44P A. flavus + ND 151.00 + 16.29 ND 0.40 + 0.10 151.40 + 16.58 45P A. flavus + ND 135.10 + 7.64 ND 0.23 + 0.03 135.33 + 5.96 148 Table 3 Continued. Isolate code Identification CAM Aflatoxins concentration in YES broth (ng ml-1 medium + SE) G1 B1 G2 B2 Total AFs 59P A. flavus + ND 115.00 + 93.12 ND 3.50 + 0.32 118.50 + 11.28 86P A. flavus + ND 385.00 + 65.19 ND 4.70 + 0.35 389.70 + 25.85 87P A. flavus ++ ND 545.70 + 202.34 ND 7.70 + 0.32 553.40 + 18.30 88P A. flavus ++ ND 1136.00 + 143.61 ND 13.70 + 1.14 1149.70 + 56.98 89P A. flavus ++ ND 675.40 + 116.54 ND 12.00 + 0.93 687.40 + 23.28 90P A. flavus + ND 319.80 + 71.77 ND 4.90 + 0.35 324.70 + 17.62 96P A. flavus + ND 102.50 + 6.96 ND 0.60 + 0.09 103.10 + 5.31 97P A. flavus + ND 94.20 + 14.35 ND 1.20 + 0.18 95.40 + 6.13 107P A. flavus + ND 128.70 + 230.26 ND 0.60 + 0.10 129.30 + 10.48 108P* A. flavus ++ ND 808.40 + 205.68 ND 7.60 + 0.41 816.00 + 13.94 109P A. flavus ++ 553.10 + 26.70 190.00 + 374.50 4.80 + 0.41 2.50 + 0.18 750.40 + 36.89 110P* A. nomius +++ 1822.60 + 64.94 1313.10 + 432.15 24.40 + 2.28 22.30 + 2.11 5621.90 + 102.13 112P A. flavus - ND 1.20 + 0.10 ND ND 1.20 + 0.10 * = Accession number of ITS sequence of the selected isolates 1E: MN511742/ITS, 16E: JF729324/ITS, 21E: MG554234/ITS, 42E: MH595954/ITS, 45E: MH595954/ITS, 7P: MH752557/ITS, 9P: AY510454/ITS, 32P: KF432854/ITS, 108P: MN511745/ITS, 110P: MN511744/ITS Almost all toxigenic isolates (99.4%) gave different blue fluorescence density under UV lamp at the reverse sides of the CAM medium plates except one isolate (112P). In general, the potential hazard of the Philippines isolates, notably A. nomius isolates, was statistically (P<0.05) much higher than those from Egypt. The levels of AFG1 were higher than those of AFB1 in cultures of all A. nomius isolates and the isolate A. flavus 109P. All aflatoxin-producing isolates produced AFB1 in the range 0.5 to 13189 ng ml-1 medium. The highest concentration of AFB1 was produced by isolate 6P which was isolated from a soil sample of coconut field in Philippines. All 14 Egyptian aflatoxin-producing isolates were unable to produce AFG1 and AFG2, while 12 isolates from the Philippines were AFG1 producers and seven of them produced AFG2 also. Based on HPLC analyses, there were four chemotypes of aflatoxins producers: (1) isolates producing all four aflatoxin types (16%, seven isolates), (2) isolates producing AFB1 only (18.5%, 8 isolates), (3) isolates producing AFB1 and AFB2 (53.5%, 23 isolates), and (4) those producing AFB1 and AFG1 (12%, 5 isolates). All six A. nomius isolates belonged to chemotype one and produced all four AFs (total amount 2400-40400 ng ml-1). In contrast, the other isolates (37) which belonged to A. flavus produced <1200 ng ml-1 total AFs. Only one A. flavus isolate from the Philippines was capable of producing all four AFs. Molecular detection of aflatoxin-producing Aspergillus isolates: The results of the tested isolates PCR with primer pairs of ITS1/ITS4, ver-1/ver-2 and ordA-F/ordA-R are summarized in Table 4. All 43 A. flavus and A. nomius aflatoxin-producing isolates had the ITS1/ITS4 primer pair which referred to how optimal DNA extraction was (Fig. 1a). The PCR with ver-1/ve r-2 primer pair showed three different profiles of PCR products (Fig. 1b); (a) one band at around 537bp (all A. nomius and half A. flavus isolates), (b) one band at around 700bp (A. flavus isolates 88P, 89P and 90P) and (c) two bands: at around 537bp and 700bp (A. flavus isolates 23E, 29E, 35E, 41P, 44P, 45P, 59P, 86P, 87P, 96P, 97P, 107P, 108P, 109P, 112P). However, the PCR product of ordAF/ordAR primer pair (Fig.1c) gave one main band at around 400bp. The atoxigenic A. flavus isolates produced PCR products with the ITS1/ITS4 primer pair, whereas it had no bands with either ver-1/ver-2 or ordA-F/ordA-R primer pairs. Based on the ITS sequences, the morphological identification of seven A. flavus isolates (1E, 16E, 21E, 42E, 45E, 32P and 108P) and three A. nomius isolates (7P, 9P and 110P) were 149 confirmed by comparing their ITS sequences with known ITS sequences in GenBank (sub-notes, Table 3). In the phylogenetic parsimonious consensus tree (Fig. 2), A. nomius isolates formed a clear cluster with known A. nomius isolate NRRL 13137 (AF027860) and were separated from A. flavus isolates including known A. flavus isolate NRRL 1957 (AF027863) and from known A. parasiticus isolate NRRL 502 (NR121219). Table 4 The results of PCR with ITS 1/ITS4 for confirming the quality of DNA and ver-1/ver-2 and ordA-F/ordA-R for detecting ver-1 gene and ordA gene in aflatoxin-producing fungi respectively. PCR product Positive isolates ITS 1/ITS4 (650-700 bp) All isolates ver-1/ver-2 (537bp) only All isolates except A. flavus isolates 23E, 29E, 35E, 41P, 44P, 45P, 59P, 86P, 87P, 88P, 89P, 90P, 96P, 97P, 107P, 108P, 109P and 112P ver-1/ver-2 (700 bp) only A. flavus isolates 88P, 89P and 90P ver-1/ver-2 (537bp + 700 bp ) A. flavus isolates 23E, 29E, 35E, 41P, 44P, 45P, 59P, 86P, 87P, 96P, 97P, 107P, 108P, 109P, 112P ordA-F/ordA-R(400bp) All isolates Fig. 1 – Band pattern of different Aspergillus species isolates as resulted from PCR reaction primed by primer pairs of a) ITS 1/ITS4 , b) ver-1/ver-2 and c) ordA-F/ordA-R. In the upper part of gel, 150 Lanes: Lane 1 = 1 Kb DNA ladder, Lane 2 = IE, Lane 3 = 3E, Lane 4 = 16E, Lane 5 = 21E, Lane 6 = 23E, Lane 7 = 29E, Lane 8 = 34E, Lane 9 = 35E, Lane 10 = 40E, Lane 11 = 41E, Lane 12 = 42E, Lane 13 = 43E, Lane 14, Lane 15 = 45E, Lane16 = 6P, Lane17=7P, Lane18 = 8P, Lane19 = 9P, Lane20 = 10P, Lane21 = 18P, Lane22 = 32P, Lane23 = 33P, Lane24 = 34P, Lane25 = 35P, Lane26 = 36P, Lane27 = 41P, Lane28 = 42P, Lane29 = 43P, Lane30 = 1 Kb DNA ladder. In the lower part of the gel, Lanes: Lane 1 = 1 Kb DNA ladder, Lane 2 = 44P, Lane 3 = 45P, Lane 4 = 59P, Lane 5 = 86P, Lane 6 = 87P, Lane 7 = 88P, Lane 8 = 89P, Lane 9 = 90P, Lane 10 = 96P, Lane 11 = 97P, Lane 12 = 107P, Lane 13 = 108P, Lane 14 = 109P, Lane 15 = 110P, Lane16 = 112P, Lane17 = atoxigenic A. flavus, Lane18 = positive control (A. flavus), Lane19 = negative control Fig. 2 – Consensus tree of 55 most parsimonious trees based on the ITS sequences of ten Aspergillus isolates as compared to reference isolates from GenBank. Only bootstrap values supported by more than 50% of the tree are marked. Discussion In the present study, a total of 160 A. section Flavi isolates obtained from soil, maize, wheat, coconut, and peanuts showed a characteristic yellow-orange reverse colour on AFPA medium. These results confirmed the effectiveness of this medium for the detection of A. section Flavi as reported by Pitt et al. (1983). A. nomius isolates were identified according to Varga et al. (2011). Visually, they had fluffy shape on YES medium and less sporulation than that of A. flavus isolates. The isolates of A. nomius were only found in soil samples from coconut fields in the Philippines, while all Egyptian isolates were identified as A. flavus. Similarly, A. nomius become predominant aflatoxigenic species found in soil samples of Japan (Kumeda et al. 2003) and Thailand (Ehrlich et al. 2007). About a quarter of the identified isolates were aflatoxigenic according to HPLC analysis (Table 3). The ratio of aflatoxin-producing isolates from Egyptian samples (31%) was higher than that for isolates from the Philippines samples (25%); however most of them were unable to produce AFG1 and AFG2. Also, the total AF production by the Egyptian isolates was less than that of the Philippine isolates with values from 0.5 to 852 ng ml-1 medium. This finding could be attributed to the differences in the source of isolation; the Egyptian isolates were mainly from maize, wheat, and soil samples while the majority of the Philippines isolates were from soil samples of coconuts and maize fields. Also, because of the location and climate of the Philippines which is characterized by 151 higher relative humidity (Ilag 1984) than that of Egypt made the soils more susceptible for the fungal invasion at pre-harvest stage. About a quarter of the identified isolates was aflatoxigenic according to HPLC analysis (Table 3). The ratio of aflatoxin-producing isolates from Egyptian samples (31%) was higher than that for isolates from the Philippines samples (25%); however most of them were unable to produce AFG1 and AFG2. Also, the total AF production by the Egyptian isolates was less than that of the Philippine isolates with values from 0.5 to 852 ng ml-1 medium. This finding could be attributed to the differences in the source of isolation; the Egyptian isolates were mainly from maize, wheat, and soil samples while the majority of the Philippines isolates were from soil samples of coconuts and maize fields. Also, because of the location and climate of the Philippines which is characterized by higher relative humidity (Ilag 1984) than that of Egypt made the soils more susceptible for the fungal invasion at pre-harvest stage. A. flavus is known to produce AFBs (Varga et al. 2009). Most of the A. flavus isolates in present study (31) produced AFBs, either AFB1 alone or both AFB1 and AFB2 together, whereas A. flavus isolate 109P produced the four types and A. flavus isolates 18P, 32P, 33P, 34P &35P produced both AFB1 and AFG1 chemotypes. Regarding the A. nomius isolates, high levels of aflatoxin were produced in media. The occurrence of such isolates as predominant species was observed for the first time in coconut field soils in the Philippines. This finding is in agreement with the previous records of the highly aflatoxin-contaminated “copra” (dried coconut meat) which has resulted in the suspension of the Philippines from exporting copra meal into Europe in 2004 (Bawalan 2004). In addition, all isolated species from maize, wheat and soil associated with these crops have been identified as A. flavus. This suggests that there may be a relationship between the associated crop and the type of aflatoxin-producing fungi. Data obtained by Pildain et al. (2004) showed that the frequencies of Aspergillus section Flavi varied among both fields and crops being cultivated. Although A. flavus is not host specific fungus (St Leger et al. 2000), the distribution of different Aspergillus section Flavi species suggests that they may be adapted to specific niches and exhibit competitive advantages in specific soil types, hosts, regions, and seasons (Jaime-Garcia & Cotty 2006). Variation in the quantity and types of AFs produced by each isolate referred to the diversity of the isolated fungi as it has been found previously (Cotty 1989). Fluorescent detection on CAM was confirmed with the HPLC analysis of aflatoxins except for one isolate (112P), which gave no fluorescence on CMA. Similar results were obtained by Sultan & Magan (2010) who examined the potential aflatoxin production by isolates of A. flavus and A. parasiticus from Egyptian peanuts. They found that there was 90% compatibility of the results between HPLC and the coconut agar method. Also, Rodrigues et al. (2009) reported that HPLC results had a good correlation with aflatoxin production by fluorescence in CAM. Concerning the genetic identification of the aflatoxigenic isolates in the current study, a similar study had been made in north-eastern Iran (Davari et al. 2015). They recognized 28 aflatoxigenic strains of A. flavus and A. parasiticus through amplification of four genes involved in the aflatoxin biosynthesis pathway (nor1, ver1, omtA and aflR) followed by thin layer chromatography as a confirmation method. Furthermore, the genetic variability between 109 A. flavus strains isolated from maize in Kenya, were analyzed for the presence of four AF genes with their ability to produce aflatoxins, targeting aflR, aflP, aflD, and aflQ genes (Okoth et al. 2018). DNA isolation from the fungal material was performed over a relatively short time period (3 days incubation) in small amounts of broth medium in Eppendorf tubes. This approach reduced the time and amount of the medium necessary for preparing mycelial biomass (20 ml for 7 days) (Rodrigues et al. 2009, Sultan & Magan 2010). The ITS primers were chosen as the standard markers for fungal DNA barcoding of Aflatoxigenic isolates to confirm the existence of enough PCR products for the next molecular identification steps of aflatoxins genes (Yli-Mattila et al. 2004). For molecular detection of aflatoxin production, two genes were chosen (a) the ver-1 gene, versicolorin A dehydrogenase, which converts the versicolin A to sterigmatocystin in the middle of the aflatoxin biosynthetic pathway (Yu et al. 2004) and (b) the ord1 gene which is considered to be 152 the only gene involved in the last step of transforming O-methylsterigmatocystin into AFB1, an important step in the aflatoxin biosynthesis pathway that appears to unique to aflatoxigenic species (Prieto & Woloshuk 1997). Molecular detection of aflatoxin production by using the ver-1/ver-2 primer pair as described previously (Färber et al. 1997) and ordAF/ordAR primers pair as described by Chang et al. (2005) is in accordance with the results obtained from HPLC analyses of AFs and CAM methods. However, the presence of the aflatoxin biosynthetic genes does not always accompany with the occurrence of aflatoxin (Rodrigues et al. 2009). The present observations led to the use of both genes in recognition of the aflatoxigenic isolates on grain samples in a shorter time than the time- consuming traditional methods (Degola et al. 2007). Similar study but on toxigenic Fusarium revealed that the detection of the toxigenic strains by molecular approach was more effective than HPLC even at the low or negligible level of fumonisins (Abd-El Fatah et al. 2015). The PCR products profile with the ver-1/ver-2 primer pair showed differences in A. flavus and A. nomius isolates. Two new PCR profiles with the ver gene primers were detected in the present isolates. The first profile observed as one band at a molecular weight (700 pb) higher than the reported one and the second profile exhibited as two bands, one at the ordinary (537 pb) and 700pb. Similar PCR products were reported by Geisen (1996), who tested Penicillium roqueforti using primers for the same gene. He got also two bands as well and attributed that to the owning genomic sequences similar to that gene. According to these results, the two new PCR profiles with ver gene can be considered new genotypes. This revealed to the ability to use this primer pair in identifying the diversity of aflatoxin-producing fungi but not for distinguishing the aflatoxigenic fungi from other species with the same gene. Sequencing of more genes is required to confirm the presence of the 3 genotypes. In conclusion, the examined aflatoxin-producing fungal isolates showed variability in the types and the quantity of AFs production based on the region of origin. The PCR results with ver- 1/ver-2 primer pair were successfully used for studying the diversity of aflatoxigenic fungi from different region, but not for differentiation between fungal species as a molecular marker. On the other hand, ordAF/ordAR primers pair was used for the screening of the contaminated grain samples for the presence of Aspergillus section Flavi species. Finally, further work is required using RAPD and ISSR PCR to confirm the separation of aflatoxin-producing isolates into different genotypes. Acknowledgements This work was financially supported by Egyptian mission department, Turku University Foundation and The Centre for International Mobility, Finland (CIMO) travel. References Abd-El Fatah SI, Naguib MM, El-Hossiny EN, Sultan YYet al. 2015 – Molecular versus Morphological Identification of Fusarium spp. isolated from Egyptian corn. Research Journal of Pharmaceutical, Biological and Chemical Sciences 6, 1813–1822. Alberts JF, Engelbrecht Y, Steyn PS, Holzapfel WH, van Zyl WH. 2006 – Biological degradation of aflatoxin B1 by Rhodococcus erythropolis cultures. International Journal of Food Microbiology 109, 121–126. Anon 2001 – The Times Comprehensive Atlas of the World, 10th ed. Times Book Group Ltd, London: ISBN 0-7230-0792-6. 67, 220, 124 plates pp. http://www.marineregions.org/ AOAC 2019 – Natural toxins. In Official methods of analysis, 21st ed. Association of Official Analytical Chemists: Washington D.C., 2019. Arim RH. 2004 – Mycotoxin Contamination of Foods and Feeds in the Philippines, FAO/WHO Regional Conference on Food Safety for Asia and Pacific, Seremban, Malaysia, pp. 13. 153 Balendres MAO, Karlovsky P, Cumagun CJR. 2019 – Mycotoxigenic fungi and mycotoxins in agricultural crop commodities in the Philippines: a review. Foods 8, 249 doi: 10.3390/foods8070249. Bawalan DD. 2004 – Copra: The Philippines. In Crop Post-Harvest: Science and Technology, 2nd ed.; Rick, H.; Graham, F., Eds.; Blackwell Science Ltd: Blackwell Science Ltd, 9600 Garsington Road, Oxford OX4, pp. 197–206. Bhatnagar D, Cary JW, Ehrlich K, Yu J, Cleveland TE. 2006 – Understanding the genetics of regulation of aflatoxin production and Aspergillus flavus development. Mycopathologia 162, 155–166. Cary JW, Ehrlich KC, Kale SP, Calvo AM et al. 2006 – Regulatory elements in aflatoxin biosynthesis. Mycotoxin Research 22, 105–109. CAST 2003 – Mycotoxins: risks in plant animal and human systems. Ames, Iowa: Council for Agricultural Science and Technology. 199pgs Chang PK, Horn BW, Dorner JW. 2005 – Sequence breakpoints in the aflatoxin biosynthesis gene cluster and flanking regions in nonaflatoxigenic Aspergillus flavus isolates. Fungal Genetics and Biology 42, 914–923. Chang PK, Skory CD, Linz JE. 1992 – Cloning of a gene associated with aflatoxin B1 biosynthesis in Aspergillus parasiticus. Current Genetics 21, 231–233. Chen RS, Tsay JG, Huang YF, Chiou RY. 2002 – Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction. Journal of Food Protection 65, 840–844. Cotty PJ. 1989 – Virulence and cultural characteristics of two Aspergillus flavus strains pathogenic on cotton. Phytopathology 79, 808–814. Cotty PJ. 1994 – Comparison of four media for the isolation of Aspergillus flavus group fungi. Mycopathologia 125, 157–162. Cotty PJ, Jaime-Garcia R. 2007 – Influences of climate on aflatoxin producing fungi and aflatoxin contamination. International Journal of Food Microbiology 119, 109–115. Cullen JM, Ruebner BH, Hsieh LS, Hyde DM, Hsieh DP. 1987 – Carcinogenicity of dietary aflatoxin M1 in male Fischer rats compared to aflatoxin B1. Cancer Research 47, 1913–1917. Davari E, Mohsenzadeh M, Mohammadi G, Rezaeian-Doloei R. 2015 – Characterization of aflatoxigenic Aspergillus flavus and A. parasiticus strain isolates from animal feedstuffs in northeastern Iran. Iranian Journal of Veterinary Research 16, 150–155. Degola F, Berni E, Dall’Asta C, Spotti E et al. 2007 – A multiplex RT-PCR approach to detect aflatoxigenic strains of Aspergillus flavus. Journal of Applied Microbiology 103, 409–417. Donner M, Atehnkeng J, Sikora RA, Bandyopadhyay R, Cotty PJ. 2009 – Distribution of Aspergillus section Flavi in soils of maize fields in three agroecological zones of Nigeria. Soil Biology and Biochemistry 41, 37–44. Ehrlich KC, Kobbeman K, Montalbano BG, Cotty PJ. 2007 – Aflatoxin-producing Aspergillus species from Thailand. International Journal of Food Microbiology 114, 153–159. el-Tahan FH, el-Tahan MH, Shebl MA. 2000 – Occurrence of aflatoxins in cereal grains from four Egyptian governorates. Nahrung 44, 279–280. European Commission. 2010 – Commission Regulation (EC) No. 165/2010, of 26 February 2010 amending Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards Aflatoxins. Official Journal of the European Union 50, 11–12. Färber P, Geisen R, Holzapfel WH. 1997 – Detection of aflatoxinogenic fungi in figs by a PCR reaction. International Journal of Food Microbiology 36, 215–220. Garcia R, Ilag L. 1986 – Aflatoxin in the Philippines, Workshop of CIMMYT: Aflatoxin in Maize, El Batan, Mexico, pp. 365–372. Geisen R. 1996 – Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi. Systematic and Applied Microbiology 19, 388–392. 154 Ilag L. 1984 – Workshop on Mycotoxin Research in the Philippines, Mycotoxin Contamination of Food and Feed Commodities, Cabanatuan City, Nueva Ecija, pp. 8–19. Iyer P, Zekri AR, Hung CW, Schiefelbein E et al. 2010 – ConcordAnce of DNA methylation pattern in plasma and tumor DNA of Egyptian hepatocellular carcinoma patients. Experimental and Molecular Pathology 88, 107–111. Jaime-Garcia R, Cotty PJ. 2006 – Spatial Relationships of Soil Texture and Crop Rotation to Aspergillus flavus Community Structure in South Texas. Phytopathology 96, 599–607. Kumeda Y, Asao T, Takahashi H, Ichinoe M. 2003 – High prevalence of B and G afatoxin- producing fungi in sugarcane field soil in Japan: heteroduplex panel analysis identifies a new genotype within Aspergillus Section Flavi and Aspergillus nomius. FEMS Microbiology Ecology 45, 229–238. Lin M, Dianese J. 1976 – A coconut agar medium for rapid detection of afatoxin production by Aspergillus species. Phytopathology 66, 1466–1469. Lubulwa G, Davis J. 1994 – Estimating the Social Costs of the Impacts of Fungi and Aflatoxins, 6th International Working Conference on Stored-product Protection (6th IWCSPP), National Convention Centre, Canberra, Australian Capital Territory, pp. 10. Magan N, Medina A, Aldred D. 2011 – Possible climate change effects on mycotoxin contamination of food crops pre- and post-harvest. Plant Pathology 60, 150–163. Medina Á, Rodríguez A, Sultan Y, Magan N. 2015 – Climate change factors and Aspergillus flavus: effects on gene expression, growth and aflatoxin production. World Mycotoxin Journal 8, 171–179. Moubasher AH, el-Kady IA, Shoriet A. 1977 – Toxigenic Aspergilli isolated from different sources in Egypt. Annales De La Nutrition Et De L’Alimentation 31, 607–615. Okoth S, De Boevre M, Vidal A, Diana Di Mavungu J et al. 2018 – Genetic and Toxigenic Variability within Aspergillus flavus Population Isolated from Maize in Two Diverse Environments in Kenya. Frontiers in Microbiology 9:57. doi: 10.3389/fmicb.2018.00057. Paavanen-Huhtala S, Hyvonen J, Bulat S, Yli-Mattila T. 1999 – RAPD-PCR, isozyme, rDNA RFLP and rDNA sequence analyses in identification of Finnish Fusarium oxysporum isolates. Mycological Research 103, 625–634. Pildain MB, Vaamonde G, Cabral D. 2004 – Analysis of population structure of Aspergillus flavus from peanut based on vegetative compatibility, geographic origin, mycotoxin and sclerotia production. International Journal of Food Microbiology 93, 31–40. Pitt JI, Hocking AD, Glenn DR. 1983 – An improved medium for the detection of Aspergillus flavus and A. parasiticus. Journal of Applied Bacteriology 54, 109–114. Prieto R, Woloshuk CP. 1997 – Ord1, an oxidoreductase gene responsible for conversion of O- methylsterigmatocystin to aflatoxin in Aspergillus flavus. Applied and Environmental Microbiology 63, 1661–1666. Rodrigues P, Santos C, Venancio A, Lima N. 2011 – Species identification of Aspergillus section Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and molecular approaches. Journal of Applied Microbiology 111, 877–892. Rodrigues P, Venancio A, Kozakiewicz Z, Lima N. 2009 – A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus Section Flavi isolated from Portuguese almonds. International Journal of Food Microbiology 129, 187–193. Shapira R, Paster N, Eyal O, Menasherov M et al. 1996 – Detection of aflatoxigenic molds in grains by PCR. Applied and Environmental Microbiology 62, 3270–3273. St Leger RJ, Screen SE, Shams-Pirzadeh B. 2000 – Lack of host specialization in Aspergillus flavus. Applied Environmental Microbiology 66, 320–324. Sultan Y, Magan N. 2010 – Mycotoxigenic fungi in peanuts from different geographic regions of Egypt. Mycotoxin Research 26, 133–140. Varga J, Frisvad JC, Samson RA. 2009 – A reappraisal of fungi producing aflatoxin. World Mycotoxin Journal 2, 263–277. 155 Varga J, Frisvad JC, Samson RA. 2011 – Two new aflatoxin producing species, and an overview of Aspergillus section Flavi. Studies in Mycology 69, 57–80. Wogan GN, Kensler TW, Groopman JD. 2012 – Present and future directions of translational research on aflatoxin and hepatocellular carcinoma. A review. Food Additives & Contaminants: Part A: Chemistry, Analysis, Control, Exposure & Risk Assessment 29, 249– 257. Yli-Mattila T, Hussien T, Gavrilova O, Gagkaeva T. 2018 – Morphological and Molecular Variation Between Fusarium avenaceum, Fusarium arthrosporioides and Fusarium anguioides Strains, Pathogens 7, 94. Yli-Mattila T, Mach RL, Alekhina IA, Bulat SA et al. 2004 – Phylogenetic relationship of Fusarium langsethiae to Fusarium poae and Fusarium sporotrichioides as inferred by IGS, ITS, beta-tubulin sequences and UP-PCR hybridization analysis. International Journal of Food Microbiology 95, 267–285. Yli-Mattila T, Paavanen-Huhtala S, Jestoi M, Parikka P et al. 2008 – Real-time PCR detection and quantification of Fusarium poae, F. graminearum, F. sporotrichioides and F. langsethiae in cereal grains in Finland and Russia. Archives of Phytopathology and Plant Protection 41, 243–260. Yu J, Bhatnagar D, Cleveland TE. 2004 – Completed sequence of aflatoxin pathway gene cluster in Aspergillus parasiticus. FEBS Letters 564, 126–130.